what is if the dna coding sequence was cga atc the mrna would be?

Best Answer

if the dna coding sequence was cga-atc the mrna would be. ... what modification occurs to the mrna ... what specifically determines the sequence of amino acids in a ... - read more

Second Best Answer

... molecule is produced through the transcription of DNA, and next, the mRNA serves as a ... The mRNA sequence is thus used as a ... of the coding region, and it ... - read more


Please vote if the answer you were given helped you or not, thats the best way to improve our algorithm. You can also submit an answer or search documents about how do you transfer songs from our ipod to my son s new mp3 player.




what is if the dna coding sequence was cga atc the mrna would be? community answers



what is if the dna coding sequence was cga atc the mrna would be Resources

... (from coding DNA sequence), is that portion of a gene's DNA or RNA, ... The coding region in mRNA is bounded by the five prime untranslated region ... ... read more
If the DNA coding sequence was CGA-ATC, the mRNA would be Answer : GCU-UAG. AUC-CGA. UAG-GCU. GCT ... the mRNA would be Answer : GCU-UAG. AUC-CGA. UAG-GCU. ... read more
The mRNA sequence is determined by the sequence of genomic DNA. ... CGA: A; CTG: CCG: CAG: ... the first ATG in an mRNA's coding region is where ... ... read more
Oct 03, 2011 · ... What is the mRNA codon strand for the DNA ... What is the mRNA codon strand for the DNA coding strand 5 ... convert the mRNA sequence to the DNA ... ... read more
The coding DNA strand, ... (the sequence of the mRNA is complementary to the template strand and identical to the ... CGA " CGG " A. ATT Ile (I) ATC " ATA " ATG Met ... ... read more
... the mRNA would be Answer : GCU-UAG. AUC-CGA. UAG-GCU. GCT-TAG. ... If the DNA coding sequence was CGA-ATC, the mRNA would be Answer : GCU-UAG. AUC-CGA. ... read more
An explanation of the Genetic Code: DNA is a two ... codons along the sequence of the coding or sense strand of DNA as it ... (mRNA) containing the coding sequence. ... read more
Process in which mRNA is synthesized from the template DNA ... coding sequence missing from ... ATG GCT GGG AAT ATC mRNA - AUG GUG GGG GCA UAC CGA CCC ... ... read more
Protein coding sequences are DNA sequences that are transcribed into mRNA and in which the corresponding mRNA ... coding regions. The DNA sequence ... Protein coding ... ... read more
Generate antiparallel, complement and inverse sequences. ... Create the antiparallel DNA or RNA strand. For example, the sequence "ATGC" is converted to "GCAT". ... read more
DNA to mRNA for three diferent strands of DNA, ... That is the coding sequence, noncoding DNA sequences can in ... Here is how mRNA is created: coding DNA gets ... ... read more
answers for constructing a protein lab dna template number 1 dna att caa cac atc cag cca cat mrna uaa guu gug uag guc ggu gua ... mrna cga ggc ucu ccu ccg ucu ccc ... read more
Use the Genetic Code Chart to Fill in ... CGA AGT TTC GAG ACT TTT AAA CAT TAC ATC 1. Determine the corresponding DNA strand 2. Determine the mRNA sequence that ... ... read more
... DNA words are three letters long, DNA from the Beginning ... What is the mRNA sequence ... What happens if there is a mutation in the DNA sequence and the mRNA ... ... read more
Jul 15, 2008 · Find the correct complementary DNA sequence ... mRNA B. tRNA C. rRNA D. DNA 15. mRNA has the following codons: ACU-GGU-CGA. What ... Biology help ? 1. From ... ... read more
GCU UAG b AUC CGA c UAG GCU d UAG CGU e none of these ANS A PTS 1 DIF Moderate from BIOLOGY ... If an mRNA carries AUCGUG as a sequence, ... the coding DNA strand. b. ... read more
Amino Acid. SLC: DNA codons. ... combinations of the DNA coding ... the three stop codons that signals the end of a sequence. While DNA can be ... ... read more
Transcription and Translation Tool Converts DNA to RNA to protein. DNA sequence: RNA sequence: ... messenger RNA (mRNA) ... ... read more
MRNA sequence. 3' GUCAGAUGGAUAACUCAUGACAGGUACCA 5'determine the template DNA sequence? ... to the sequence atc on DNA ... to mRNA, ex: DNA: ATT GCT CGG mRNA:UAA CGA ... ... read more
What would the complementary mRNA strand be for this gene atc cgt tat gta cca? ... The mRNA sequence that is complementary to the sequence atc on DNA is? ... read more
Apr 02, 2014 · ... GAC ATA TTA CTT CGT TGA ATC Given the DNA sequence above type ... is the coding strand, then the mRNA will be ... DNA to RNA, find the sixth ... ... read more
Control of protein synthesis ... What will be the sequence of bases on the mRNA strand if the strand of DNA to be transcribed has the following ... DNA (coding strand ... ... read more
in-silico. Project support for life sciences. Home; Services; Tools; About; ... The Nucleotide Conversion tool can convert a DNA sequence into an amino acid sequence, ... ... read more
Decoding DNA Part 1: DNA ... Use the template DNA sequence to determine the complementary DNA sequence created during DNA ... mRNA AUG AUU GUG CUA CAU AUA CCA UAC ... ... read more
Codons and amino acids : Last modified October, 2009: ... ATC, ATT: K: Lys: Lysine: AAA, AAG: L: Leu: ... DNA, RNA, protein, ... ... read more
Finding ORF of a Given Sequence.. ... DNA is transcribed to mRNA in the nucleus and moves to the ... ATG GCT AGC GAT GTG ATC GAG CCC TAC CGA ACC GAT CCA TGA GAG ... ... read more
SAY IT WITH DNA: Protein Synthesis ... teach themselves the sequence of DNA-Translation (DNA-mRNA-tRNA ... AAA CTT ACT TAG AGC ATT CCT GCC CTT CGA TGC ATC SOLUTION ... ... read more
TRANSCRIPTION AND TRANSLATION ... The 3' poly A tail also delays degredation of the coding sequence of the mRNA by ... DNA strand: TA TAC ACC AGA GCT ATC CCG ... ... read more